Common use of PRIMERS Clause in Contracts

PRIMERS. Primer sequences were obtained from the original publication using these mice (102). Primers (Sigma-▇▇▇▇▇▇▇; Merck KGaA) were initially diluted to 100µM in AE buffer (Qiagen, Inc.), and then a 10µM working solution was made and stored at -20˚C. Floxed ephrin B2: Forward (a): CTTCAGCAATATACACAGGATG Reverse (b): TGCTTGATTGAAACGAAGCCCGA Reverse (c): AATACTGTTACTACAGGGTCC Cre: Forward: GCCTGCATTACCGGTCGATGCAACGA Reverse: GTGGCAGATGGCGCGGCAACACCATT