PRIMERS Clause Samples
PRIMERS. Provide a nonstaining, quick-drying type and consistency recommended by the sealant manufacturer for the particular application.
PRIMERS. Primer sequences were obtained from the original publication using these mice (102). Primers (Sigma-▇▇▇▇▇▇▇; Merck KGaA) were initially diluted to 100µM in AE buffer (Qiagen, Inc.), and then a 10µM working solution was made and stored at -20˚C. Floxed ephrin B2: Forward (a): CTTCAGCAATATACACAGGATG Reverse (b): TGCTTGATTGAAACGAAGCCCGA Reverse (c): AATACTGTTACTACAGGGTCC Cre: Forward: GCCTGCATTACCGGTCGATGCAACGA Reverse: GTGGCAGATGGCGCGGCAACACCATT
PRIMERS. A. Epoxy: 1. Lead free, chrome free, rust inhibitive, two-component epoxy primer specifically designed for use on metal substrates and in conjunction with epoxy grout. The epoxy primer shall be a product of the epoxy grout manufacturer.
B. Cementitious Nonshrink: 1. Lead-free, chrome free, rust inhibitive, two-component cementitious non-shrink primer specifically designed for use on metal substrates and in conjunction with cementitious non-shrink grout. The cementitious non-shrink primer shall be a product of the cementitious non-shrink grout manufacturer.
PRIMERS. Primers were synthesised by MWG-Biotech and diluted to a working stock solution of 2 µM. The melting temperature (Tm) is defined as the temperature at which half of the strands are in the double-helical state and half are in the “random-coil” state. Different formulas for calculating Tm have been described in the literature; consequently, Tm varies according to the formula chosen for their calculation. In the present work, Tm were calculated by MWG-Biotech and provided with each oligonucleotide synthesis report (Tm = 69.3 + 0.41 x GC % - 650/length of sequence). The primers used in this work are described in Table 2.1.
PRIMERS. 3 Sealing compound, each type, including compatibility when different sealants are in contact with each other.
PRIMERS to manufacturer's recommendation for specific material, substrate, and end use.