PRIMERS Sample Clauses

PRIMERS. Provide a nonstaining, quick-drying type and consistency recommended by the sealant manufacturer for the particular application.
AutoNDA by SimpleDocs
PRIMERS. Primer sequences were obtained from the original publication using these mice (102). Primers (Sigma-Xxxxxxx; Merck KGaA) were initially diluted to 100µM in AE buffer (Qiagen, Inc.), and then a 10µM working solution was made and stored at -20˚C. Floxed ephrin B2: Forward (a): CTTCAGCAATATACACAGGATG Reverse (b): TGCTTGATTGAAACGAAGCCCGA Reverse (c): AATACTGTTACTACAGGGTCC Cre: Forward: GCCTGCATTACCGGTCGATGCAACGA Reverse: GTGGCAGATGGCGCGGCAACACCATT
PRIMERS. A. Epoxy: 1. Lead free, chrome free, rust inhibitive, two-component epoxy primer specifically designed for use on metal substrates and in conjunction with epoxy grout. The epoxy primer shall be a product of the epoxy grout manufacturer.
PRIMERS to manufacturer's recommendation for specific material, substrate, and end use.
PRIMERS. 3 Sealing compound, each type, including compatibility when different sealants are in contact with each other.
PRIMERS. Primers were synthesised by MWG-Biotech and diluted to a working stock solution of 2 µM. The melting temperature (Tm) is defined as the temperature at which half of the strands are in the double-helical state and half are in the “random-coil” state. Different formulas for calculating Tm have been described in the literature; consequently, Tm varies according to the formula chosen for their calculation. In the present work, Tm were calculated by MWG-Biotech and provided with each oligonucleotide synthesis report (Tm = 69.3 + 0.41 x GC % - 650/length of sequence). The primers used in this work are described in Table 2.1.

Related to PRIMERS

  • Inoculations The Employer agrees to pay full expenses for inoculation or immunization shots for the employee and for members of an employee’s household when such becomes necessary as a result of said employee’s exposure to contagious diseases (including AIDS, tuberculosis and hepatitis) where said officer has been exposed to said disease in the line of duty.

  • Ergonomics The supervisor/manager will provide training and equipment for staff to safely perform job functions and avoid injury. Employees should contact their supervisor if job procedures, equipment or workstations lead to risk of injury or work-related musculoskeletal disorders. Further ergonomic guidelines shall be referenced on the Environmental Health and Safety website xxx.xxx.xxxxxxxxxx.xxx.

  • Prosthodontics We Cover prosthodontic services as follows: • Removable complete or partial dentures, for Members 15 years of age and above, including six (6) months follow-up care; • Additional services including insertion of identification slips, repairs, relines and rebases and treatment of cleft palate; and • Interim prosthesis for Members five (5) to 15 years of age. We do not Cover implants or implant related services. Fixed bridges are not Covered unless they are required: • For replacement of a single upper anterior (central/lateral incisor or cuspid) in a patient with an otherwise full complement of natural, functional and/or restored teeth; • For cleft palate stabilization; or • Due to the presence of any neurologic or physiologic condition that would preclude the placement of a removable prosthesis, as demonstrated by medical documentation.

  • Probes Network hosts used to perform (DNS, EPP, etc.) tests (see below) that are located at various global locations.

  • Prosthetics Crowns and Bridges (Plan B) paying for 60% of the approved Schedule of Fees.

  • Health Screening The Contractor shall conduct a Health Needs Screen (HNS) for new members that enroll in the Contractor’s plan. The HNS will be used to identify the member’s physical and/or behavioral health care needs, special health care needs, as well as the need for disease management, care management and/or case management services set forth in Section 3.8. The HNS may be conducted in person, by phone, online or by mail. The Contractor shall use the standard health screening tool developed by OMPP, i.e., the Health Needs Screening Tool, but is permitted to supplement the OMPP Health Needs Screening Tool with additional questions developed by the Contractor. Any additions to the OMPP Health Needs Screening Tool shall be approved by OMPP. The HNS shall be conducted within ninety (90) calendar days of the Contractor’s receipt of a new member’s fully eligible file from the State. The Contractor is encouraged to conduct the HNS at the same time it assists the member in making a PMP selection. The Contractor shall also be required to conduct a subsequent health screening or comprehensive health assessment if a member’s health care status is determined to have changed since the original screening, such as evidence of overutilization of health care services as identified through such methods as claims review. Non-clinical staff may conduct the HNS. The results of the HNS shall be transferred to OMPP in the form and manner set forth by OMPP. As part of this contract, the Contractor shall not be required to conduct HNS for members enrolled in the Contractor’s plan prior to January 1, 2017 unless a change in the member’s health care status indicates the need to conduct a health screening. For purposes of the HNS requirement, new members are defined as members that have not been enrolled in the Contractor’s plan in the previous twelve (12) months. Data from the HNS or NOP form, current medications and self-reported medical conditions will be used to develop stratification levels for members in Hoosier Healthwise. The Contractor may use its own proprietary stratification methodology to determine which members should be referred to specific care coordination services ranging from disease management to complex case management. OMPP shall apply its own stratification methodology which may, in future years, be used to link stratification level to the per member per month capitation rate. The initial HNS shall be followed by a detailed Comprehensive Health Assessment Tool (CHAT) by a health care professional when a member is identified through the HNS as having a special health care need, as set forth in Section 4.2.4, or when there is a need to follow up on problem areas found in the initial HNS. The detailed CHAT may include, but is not limited to, discussion with the member, a review of the member’s claims history and/or contact with the member’s family or health care providers. These interactions shall be documented and shall be available for review by OMPP. The Contractor shall keep up-to-date records of all members found to have special health care needs based on the initial screening, including documentation of the follow-up detailed CHAT and contacts with the member, their family or health care providers.

  • Rhytidectomy Scar revision, regardless of symptoms. • Sclerotherapy for spider veins. • Skin tag removal. • Subcutaneous injection of filling material. • Suction assisted Lipectomy. • Tattooing or tattoo removal except tattooing of the nipple/areola related to a mastectomy. • Treatment of vitiligo. • Standby services of an assistant surgeon or anesthesiologist. • Orthodontic services related to orthognathic surgery. • Cosmetic procedures when performed primarily: o to refine or reshape body structures or dental structures that are not functionally impaired; o to improve appearance or self-esteem; or o for other psychological, psychiatric or emotional reasons. • Drugs, biological products, hospital charges, pathology, radiology fees and charges for surgeons, assistant surgeons, attending physicians and any other incidental services, which are related to cosmetic surgery.

  • Orthodontics We Cover orthodontics used to help restore oral structures to health and function and to treat serious medical conditions such as: cleft palate and cleft lip; maxillary/mandibular micrognathia (underdeveloped upper or lower jaw); extreme mandibular prognathism; severe asymmetry (craniofacial anomalies); ankylosis of the temporomandibular joint; and other significant skeletal dysplasias. Procedures include but are not limited to: • Rapid Palatal Expansion (RPE); • Placement of component parts (e.g. brackets, bands); • Interceptive orthodontic treatment; • Comprehensive orthodontic treatment (during which orthodontic appliances are placed for active treatment and periodically adjusted); • Removable appliance therapy; and • Orthodontic retention (removal of appliances, construction and placement of retainers).

  • Blasting Blasting shall be permitted only for road construction purposes unless advance permission is obtained from Forest Service. Whenever the Industrial Fire Precaution Level is II or greater, a fire security person equipped with a long handled round point No. 0 or larger shovel and a 5 gallon backpack pump can filled with water, will stay at location of blast for 1 hour after blasting is done. Blasting may be suspended by Forest Service, in areas of high rate of spread and resistance to control. Fuses shall not be used for blasting. Explosive cords shall not be used without permission of Forest Service, which may specify conditions under which such explosives may be used and precautions to be taken.

  • Vaccination and Inoculation (a) The Employer agrees to take all reasonable precautions, including in-service seminars, to limit the spread of infectious diseases among employees.

Draft better contracts in just 5 minutes Get the weekly Law Insider newsletter packed with expert videos, webinars, ebooks, and more!