PRIMERS Sample Clauses

PRIMERS. Provide a nonstaining, quick-drying type and consistency recommended by the sealant manufacturer for the particular application.
AutoNDA by SimpleDocs
PRIMERS to manufacturer's recommendation for specific material, substrate, and end use.
PRIMERS. 3 Sealing compound, each type, including compatibility when different sealants are in contact with each other.
PRIMERS. Primer sequences were obtained from the original publication using these mice (102). Primers (Sigma-Xxxxxxx; Merck KGaA) were initially diluted to 100µM in AE buffer (Qiagen, Inc.), and then a 10µM working solution was made and stored at -20˚C. Floxed ephrin B2: Forward (a): CTTCAGCAATATACACAGGATG Reverse (b): TGCTTGATTGAAACGAAGCCCGA Reverse (c): AATACTGTTACTACAGGGTCC Cre: Forward: GCCTGCATTACCGGTCGATGCAACGA Reverse: GTGGCAGATGGCGCGGCAACACCATT
PRIMERS. Primers were synthesised by MWG-Biotech and diluted to a working stock solution of 2 µM. The melting temperature (Tm) is defined as the temperature at which half of the strands are in the double-helical state and half are in the “random-coil” state. Different formulas for calculating Tm have been described in the literature; consequently, Tm varies according to the formula chosen for their calculation. In the present work, Tm were calculated by MWG-Biotech and provided with each oligonucleotide synthesis report (Tm = 69.3 + 0.41 x GC % - 650/length of sequence). The primers used in this work are described in Table 2.1.
PRIMERS. A. Epoxy: 1. Lead free, chrome free, rust inhibitive, two-component epoxy primer specifically designed for use on metal substrates and in conjunction with epoxy grout. The epoxy primer shall be a product of the epoxy grout manufacturer.

Related to PRIMERS

  • Ergonomics The supervisor/manager will provide training and equipment for staff to safely perform job functions and avoid injury. Employees should contact their supervisor if job procedures, equipment or workstations lead to risk of injury or work-related musculoskeletal disorders. Further ergonomic guidelines shall be referenced on the Environmental Health and Safety website xxx.xxx.xxxxxxxxxx.xxx.

  • Prosthodontics We Cover prosthodontic services as follows: • Removable complete or partial dentures, for Members 15 years of age and above, including six (6) months follow-up care; • Additional services including insertion of identification slips, repairs, relines and rebases and treatment of cleft palate; and • Interim prosthesis for Members five (5) to 15 years of age. We do not Cover implants or implant related services. Fixed bridges are not Covered unless they are required: • For replacement of a single upper anterior (central/lateral incisor or cuspid) in a patient with an otherwise full complement of natural, functional and/or restored teeth; • For cleft palate stabilization; or • Due to the presence of any neurologic or physiologic condition that would preclude the placement of a removable prosthesis, as demonstrated by medical documentation.

  • Probes Network hosts used to perform (DNS, EPP, etc.) tests (see below) that are located at various global locations.

  • Orthodontics We Cover orthodontics used to help restore oral structures to health and function and to treat serious medical conditions such as: cleft palate and cleft lip; maxillary/mandibular micrognathia (underdeveloped upper or lower jaw); extreme mandibular prognathism; severe asymmetry (craniofacial anomalies); ankylosis of the temporomandibular joint; and other significant skeletal dysplasias. Procedures include but are not limited to: • Rapid Palatal Expansion (RPE); • Placement of component parts (e.g. brackets, bands); • Interceptive orthodontic treatment; • Comprehensive orthodontic treatment (during which orthodontic appliances are placed for active treatment and periodically adjusted); • Removable appliance therapy; and • Orthodontic retention (removal of appliances, construction and placement of retainers).

  • Vaccination and Inoculation (a) The Employer agrees to take all reasonable precautions, including in-service seminars, to limit the spread of infectious diseases among employees.

  • Laboratory a. Drug tests shall be conducted by laboratories licensed and approved by SAMSHA which comply with the American Occupational Medical Association (AOMA) ethical standards. Upon advance notice, the parties retain the right to inspect the laboratory to determine conformity with the standards described in this policy. The laboratory will only test for drugs identified in this policy. The City shall bear the cost of all required testing unless otherwise specified herein.

  • Vaccinations (1) Employees shall be provided with free influenza vaccination once annually.

  • Diagnostic procedures to aid the Provider in determining required dental treatment.

  • Synchronization The Licensor hereby grants limited synchronization rights for One (1) music video streamed online (Youtube, Vimeo, etc..) for up to 500,000 non-monetized video streams on all total sites. A separate synchronisation license will need to be purchased for distribution of video to Television, Film or Video game.

  • Devices BNY Mellon will restrict the transfer of Customer Data from its network to mass storage devices. BNY Mellon will use a mobile device management system or equivalent tool when mobile computing is used to provide the services. Applications on such authenticated devices will be housed within an encrypted container and BNY Mellon will maintain the ability to remote wipe the contents of the container.

Time is Money Join Law Insider Premium to draft better contracts faster.