PCR Sample Clauses

PCR. An engineering property condition report by a firm and in a form reasonably acceptable to the Bank, at Borrower’s expense.

PCR. Polymerase chain reactions were set up by using the following reagents multiplied by the number of PCR reactions required (Table 1). For each primer a DNA sample, stored in our R&D approved bio bank, from a positive (known MDR3 deficiency) control was used to check the quality of the designed primer. A negative (no DNA) control mix, with reagents only, was also used to assure the lack of any DNA contamination of the reagents. The PCR plate was covered with an adhesive PCR seal (Anachem, Luton, UK) and the reaction was placed on a thermal cycler with a heated lid at 105 °C as per Table 2. PCR buffer GC-Rich solution dNTP mix (10 mM) FastStart Taq DNA polymerase (5 U/μl) Forward primer (10 μM) Reverse primer (10 μM) DNA Distilled water 2 μl 4 μl 0.6 μl 0.25 μl 0.5 μl 0.5 μl 2 μl 10.15 μl Temperature (oC) Time (min) Number of cycles 96 8 1 96 52-58 72 0.5 0.25 0.5 } 35 72 7 1 Table 2: PCR thermal cycle, with temperatures gradient in step 3 between 52-58 oC, depending on each exon’s annealing temperature.

PCR. To establish a profile of the transcriptional changes of the mRNA of specific cytokines and receptors induced by the SNI or and the effect of the investigated drugs on those cytokines, QRT-PCR was performed on tissue of the injured sciatic nerve and spinal cord. Naive mice (n = 5) served as reference for basal mRNA expression levels. Mice that had received SNI, with or without treatment (n = 5/group), were sacrificed 7 days post lesion. The nucleotide sequences of the PCR primers and their fluorogenic probes for the target genes were designed by using the computer program primer express (PE Biosystems) and are included in Table 1. Each fluorescent probe has a reporter dye (FAM for the target RNA and TET for the 18S RNA control) covalently attached at its 5’ end and a quencher dye (▇▇▇▇▇) attached at its 3’ end. Before use, the probes were purified in the PolyPak II cartridge (▇▇▇▇ Research, Sterling, VA) following the manufacturer’s instructions. RNA was isolated from the sciatic nerve Gene Type Sequence (5’–3’) Grin1 (NMDAR NR1) Forward GTC CAT CTA CTC TGA CAA GAG Reverse AAA CCA GAC GCT GGA CTG GT Probe f TCC ACC TGA GCT TCC TTC GCA CCGq Grin2a (NMDAR NR2A) Forward ACC TCG CTC TGC TCC AGT TT Reverse GTT GTG GCA GAT GCC CGT AA Probe f CAG TGT CTC CAG CTC TTC CAT CTC ACq Grin2b (NMDAR NR2B) Forward TGG TCT TCT CCA TCA GCA GA Reverse GTT CAT CAC GGA TTG GCG CT Probe f ATC TAC AGC TGT ATC CAC GGA GTA GCq CCL2 Forward CTG GAG CAT CCA CGT GTT G Reverse TGG GAT CAT CTT GCT GGT GA Probe f AGC CAG ATG CAG TTA ACG CCC CAC T q AIF-1 (Iba-1) Forward GCA ATT CCT CGA TGA TCC CA Reverse ATG TAC TTC ACC TTG AAG GCT Probe f CAG CAA TGA TGA GGA TCT GCC GTC CAq GFAP Forward CTC AAG AGG AAC ATC GTG GT Reverse TGC TCC TGC TTC GAG TCC TT Probe f TGA CCT CAC CAT CCC GCA TCT CCAq 18S Forward AGA AAC GGC TAC CAC ATC CA Reverse CTC GAA AGA GTC CTG TAT TGT Probe tAGG CAG CAG GCG CGC AAA TTA Cq and spinal cord from each of 5 mice in the experimental groups outlined above with the ABI Prism 6100 Automated Nucleic Acid Workstation according to the manu- facturer’s protocol. Real-time RT-PCR amplifications were employed as described in ref.21. The numbers of copies of the PCR template in the starting sample were calcu- lated by using the sequence detector software incorporated in the ABI Prism 7300 Sequence Detector System. Sense RNAs were synthesized from the standard plasmids by the manufacturer’s protocols, using a MAXIscript transcription kit (Ambion). The concentrations of purifi...

PCR. The expression of GPR38 mRNA was determined with a semiquantitative RT-PCR; β-actin mRNA expression was used for standardization of the amount of used cDNA. Total RNA from 8 control and 17 IBD (9 CD, 8 UC) mucosal tissue samples was isolated by phenol chloroform extraction of guanidinium isothiocynate lysates [25]. RNA of TE671 cells was used as positive control. With M-MLV reverse transcriptase (Invitrogen, La Jolla, CA, USA) and a random primer mix (▇▇▇▇▇▇▇▇- ▇▇ ▇▇▇▇▇, Switzerland) cDNA was synthesized from 2 µg RNA. The obtained cDNA was serially diluted from 1:4 to 1:1024. The diluted cDNA served as a template for the PCR using REDTaq™ DNA polymerase (Sigma-▇▇▇▇▇▇▇, St. ▇▇▇▇▇, MO, USA) and primers for GPR38 (forward, CACGTTGGCAGAATCATTTAC; reverse, TCCCATCGTCTTCACGTTAG) or β-actin (forward, GGGTCAGAAG- GATTCCTATG; reverse, GGTCTCAAACATGATCTGGG) (Sigma-Genosys, UK). Following amplification programs were used 1 minute 95°C; 1 minute 53°C; 1 minute 72°C 36 cycles and 30 seconds 94°C; 45 seconds 56°C; 1 minute 72°C 30 cycles for GPR38 and β-actin respectively. PCR fragments were loaded on a 1.5% agarose gel and after electrophoresis DNA was visualized with ethidium bromide under UV light and a digital picture was made. Intensity of the bands was measured with Scion (Washington D.C., USA) imaging software and plotted against starting amount of cDNA on log scale. Ratios of the integrated optical density per μg cDNA between samples and positive control were calculated. Statistics Data is expressed as median values with confidence intervals. For statistical assessment of differences between groups, ▇▇▇▇▇▇▇▇ signed ranks test and a ▇▇▇▇-▇▇▇▇▇▇▇ U-test were used for paired and unpaired data respectively. Values of P < 0.05 were considered significant. Results Motilin receptors in normal human gastrointestinal tract Quantification of motilin receptor expression With autoradiography the median motilin binding found in the colonic and ileal smooth muscle was 3 and 8 fmol/g tissue, respectively (table 3). This is lower (P < 0.05) than the amount of binding sites present in the human gastroduodenal region (93 fmol/g tissue; range 90-167) which was used as positive control. Besides binding in the muscular compartment, specific motilin binding was found in intestinal mucosa (table 3). In colon and ileum the motilin receptor expression in the mucosa was higher than in the smooth muscle (colon: 11 vs. 3 fmol/g, p≤0.06; ileum: 27 vs. 8 fmol/g, P≤0.05) (table 3), while in ...

PCR. After optimizing the annealing temperature and the MgCl2 concentration, micro plates were prepared for the template PCRs for each SNP. A total volume of 1000 μL of PCR mix was prepared for 96 well micro plates for each SNP as following: Table 2.6 PCR mixture for 96 well microplate SNP Sterile water PCR buffer ACGT mix F primer R primer MgCl2 (μl) Red taq polymera (μl) (μl) (μl) (μl) (μl) se (μl) ADIPOQ - 10066 G/A 804.0 100 8.0 4.0 4.0 60.0 20.0 ADIPOQ - 7734 C/A 784.0 100 8.0 4.0 4.0 80.0 20.0 ADIPOQ - 11391 G/A 784.0 100 8.0 4.0 4.0 80.0 20.0 ADIPOQ + 276 G/T 804.0 100 8.0 4.0 4.0 60.0 20.0 PPARA Leu162Val 804.0 100 8.0 4.0 4.0 60.0 20.0 Into each well of the PCR plate, 10 μl of PCR mix was pipetted. This was followed by pipating 1.5 μl of the DNA sample into the appropriate well. The plate was then covered and placed into Tetrad Thermocycler and programmed for the specific conditions required for the SNP. Table 2.7 PCR conditions for the selected SNPs and -7734 C/A and + 276 G/T 1 cycle at 94 °C for 6 minutes; 50 cycles at 94°C for 1 minute; 61 °C for 30 seconds; 72°C for 30 seconds; 1 cycle at 72°C for 10 minutes. 1 cycle at 94 °C for 6 minutes; 50 cycles at 94°C for 1 minute; 59 °C for PPARA Leu162Val 1 cycle at 94 °C for 6 minutes; 50 cycles at 94°C for 1 minute; 54.0 °C for 45 seconds; 72°C for 1 minutes ; 1 cycle at 72°C for 10 minutes. The completed PCR was the removed and stored in a 40C fridge ready for the Pyrosequencer.

PCR. Global and PCRSC desire to contribute and transfer to PSIS and PSIS desires to accept and receive, certain of the assets and assume certain of the liabilities of PCR, Global and PCRSC that are necessary to enable PSIS to own and operate the Business (the "Contribution") and to facilitate the Offering.