CFPR definition
Examples of CFPR in a sentence
These procedures shall continue to be implemented on all road related projects associated with THPs. Where road projects are planned to be accomplished on the landscape outside of a specific THP, Green Diamond shall utilize the CFPR procedures adapted to identification, avoidance, mitigation, and documentation of cultural resource impacts outside the purview of the California Department of Forestry.
Resources Code §§ 21000 et seq.) (“CEQA”) and certain requirements of the CFPR, timber operations covered in the PTEIR may be carried out using a “programmatic timber harvesting plan” (“PTHP”).
Any disputes which the parties are unable to resolve in such manner shall be determined in arbitration to be held under the rules of the American Arbitration Association ("AAA"), or of the Center for Public Resources ("CFPR"), Rules for Non-Administered Arbitration of Business Disputes, then in effect; the arbitration shall be before an arbitrator selected by the parties, and shall be held in Chicago, Illinois.
In order to carry out Part E.3 of the Project the Borrower shall, not later than December 31, 1988: (a) sign a protocol with INRF, providing, inter alia, for the inclusion of applied research themes in the areas of sylviculture, forest utilization, economy and protection, and rangeland development, in INRF’s work program; and (b) ensure the preparation and implementation by CFPR of a training program for the staff of DF and DREF in forest exploitation.
And then, the gene encoding the wild-type ECFP and the opal mutant, W66, was amplified with the primers CFP-F (AGGTTAGGATCCAATAATGGTGAGCAAGGGCGAG) and CFP-R (GCTTCC TCGAGATTACTTGTACAGCTCGTCCATGCCG), which are designed to generate Xho I and BamH I restriction sites to flank the gene of ECFP variants for cloning into the inducible expression vector p423 GAL1, generating plasmid p423.ECFP and p423.W66.
While both the Forest Practice Rules of California (CFPR, 2019) and the Yurok FMP recognize and allow for both even- and uneven-aged forestry management, due to the potentially negative influences of even-aged management to marten and to overall forest health and wildlife conservation, the Yurok Tribe now engages in an uneven-aged forest management strategy.
In particular, nothing in this Agreement is intended to nor shall be construed to limit or compromise the authority of the USFWS or NMFS to seek civil or criminal penalties for violations of federal law or otherwise fulfill their enforcement and other responsibilities under the ESA or other applicable law; CDFG to fulfill its responsibilities under CESA, the NCCPA, or other applicable law; or CAL FIRE to fulfill its responsibilities under the CFPA, CFPR or other applicable law.
The CFPR allows for the preparation of a program timberland environmental impact report (“PTEIR”) that assesses impacts and provides mitigation for impacts resulting from timber operations involved with an ownership, portion of an ownership, or multiple ownerships.
CDFG shall not file a non-concurrence with CAL FIRE (see section 1037.5(e) of the CFPR) regarding any PTHP without first requesting MRC to seek an extension of the PTHP review period.
CAL FIRE has jurisdiction over commercial timber harvest on non-federal lands in the State of California as set forth in the CFPA, the California Land Productivity Act of 1982, and the CFPR.