Gene. The description of the gene the gene functional subunit, or the allele mutation contained within the Original Material that makes the Original Material unique. This is specified on page 1 of this Agreement.
Gene. A gene is a unit of heredity which is transferred from a parent to child and is thought to determine some feature of the child.
Gene. Due to similarities in the results between using either part of the pezo-1 gene, it seems that RNAi methods targeting both regions of the pezo-1 gene should allow knockdown of the PEZO-1 expression. The third experimental condition that used a 165 xx xxxx-1 insert into an L4440 background vector showed no penetrance of the nonEmo phenotype indicating that no knockdown RNAi was successful in any of the strains. It was more common to see incomplete penetrance of the nonEmo phenotype within one individual worm, seen as either one gonad arm having oocytes with the nonEmo phenotype (Figure 12, for instance) or in some unique cases with fer-1 strain there appeared to be gonad arms with both nonEmo and Emo oocytes present closest to the vulva (Figures 14, 16-20). Figures 15, 18, 20, and 21 show what RNAi knockdown of the pezo-1 transcript looks like when present in both gonad arms. X. X. Xxxxxxx initially noted that nonEmo oocytes produced by pezo-1 mutant strains still transitioned to the Emo phenotype after being laid onto the growth plate. This process is clearly seen in Figures 15, 17, 18, and 21, where the uterus-located oocytes closest to the vulva are nonEmo and show distinctive fluorescent chromosomes while those laid on the growth plate have undergone endomitotic replication. It seems that the laid oocytes furthest from the vulva show the largest amount of DNA replication, suggesting that the transition between the nonEmo to Emo phenotype is, in part, determined by the time an oocyte is outside the animal. This could be due to changes in the environment of the oocyte as it has now exited the gonadal cavity of the hermaphrodite or it could also be linked with an interaction with the vulva muscles as they are squeezed out of the vulva. When looking at the rrf-3 strain, there were fewer worms that showed RNAi knockdown of the pezo-1 gene and so there were fewer gonads with nonEmo oocytes as compared to the other three strains. This is in contrast to what has been published about this strain, where it has been shown to have higher RNAi sensitivity in the gonad than any other strain and greater than wild type RNAi sensitivity in the germline. I observed a low level of response in my feeding-based RNAi experiments for all of the C. elegans strains I examined; a 10-30% penetrance amongst RNAi replica experiments has also been seen by other labs [77]. In conclusion, RNAi bacterial feeding experiments confirmed that RNAi of pezo-1 protein does cause the nonEmo ph...
Gene. The length of the amplified PCR product is also noted (right column). Primers Sequence (5' - 3') Insert EJG108 CACTGCTTGCAGCTGCCATAATCC exon 1/2 forward EJG109 GAGAGAGCCCATGTCATCATAGCAGTC exon 9/10 reverse XXX000 XXXXXXXXXXXXXXXXXXXXXXXXXX exon 9/10 forward EJG111 GAAATAGGGCTCCCGATTCACCG exon 15 reverse EJG112 CGGTGAATCGGGAGCCCTATTTC exon 15 forward EJG113 GCTAACAAAGTCAATAGTGAGTAGTAGTGG exon 1 i and j splice variants forward EJG114 GGAATACACATCCAAATATTTGAAGGCAAAC exon 19/20 reverse EJG115 GTTTGCCTTCAAATATTTGGATGTGTATTCC exon 19/20 forward EJG116 GCAGCGTACATTATCTGTCCAGGATC exon 26/27 reverse EJG117 GATCCTGGACAGATAATGTACGCTGC exon 26/27 forward XXX000 XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX exon 29/30 reverse EJG119 GATTGCATTCAAAGTATTCATGAATATTCCATTCC exon 30 forward EJG120 GTGTCTCGTGTCGTGTAACTATCCG exon 30 reverse EL1 tgcggccgcactagtcctcaggggatcctcaATGCTGGGACTTCCTG EL1/2 insert AATCGATGC forward EL2 taggcctgaattcAAAGAACTGAAGTGGATACAGAATCG EL1/2 insert reverse EL3 tgcggccgcactagtcctcaggggatcctcaATGACCTTGAATCTCG AACAAGGAAAATC EL3/4 insert forward EL4 taggcctgaattcTGGGAATGCTCTATCAATAAATCCG EL3/4 insert reverse EL7(EJ G 117) tgcggccgcactagtcctcaggggatcctcaATGGATCCTGGACAGA TAATGTACGCTGC EL7/8 insert forward EL8(EJ G 118) taggcctgaattcGAATGGAATATTCATGAATACTTTGAAT GCAATC EL7/8 insert reverse EL23 cgaaggccttcaATGACCTTGAATCTCGAACAAGGAAAAT C EL3/4 insert forward EL24 gataggcctcctaagTGGGAATGCTCTATCAATAAATCCG EL3/4 insert reverse Table 3. Primers used for PCR. Lower case letters are parts of the primer that facilitated cloning and restriction digestion and are not found in C. elegans DNA sequence.
Gene. Notwithstanding anything in this Agreement, an employee's scheduled hours of work shall not be construed as guaranteeing the employee minimum or maximum hours of work, An employee who is required to work a minimum of three (3) hours overtime following his scheduled hours of work and where it is not practical for him to enjoy his usual mealtime before commencing such work shall be granted one- half hour with pay in order that he may take a meal break in the Mint cafeteria. Under such conditions he shall be reimbursed his expenses for one
Gene. The functional unit of inheritance: a specific sequence of nucleotides along the DNA molecule, forming part of a chromosome. Gene expression: The process by which the information in a gene is used to create proteins or polypeptides. Gene families: Groups of closely related genes that make similar products. Gene mutation: A permanent alteration in the DNA sequence that makes up a gene, such that the sequence differs from what is found in most people. Mutations range in size; they can affect anywhere from a single DNA building block (base pair) to a large segment of a chromosome that includes multiple genes. Gene product: The protein or polypeptide coded for by a gene. Genetic engineering: Altering the genetic material of cells or organisms in order to make them capable of making new substances or performing new functions. Genetic polymorphism: a variation in germ-line DNA sequence among individuals, groups, or populations (e.g. a genetic polymorphism might give rise to blue eyes versus brown eyes, or population level differences in metabolic capacity). Genetic polymorphisms may be the result of chance processes or may have been induced by external agents (such as viruses or radiation). Generally, changes in DNA sequence which have been confirmed to be caused by external agents are called “mutations” rather than “polymorphisms”.
Gene. 8.1.1 The related to
Gene. Terms of this agreement shall be conducted by and interpreted in accordance with the laws of Brunei
Gene. The Hospital will provide bulletin board space for the purpose of posting notices regarding meetings and otherwise restricted to Association matters. All such notices must be signed by a of the Association Executive. Nurses will be paid once every two weeks. Seniority lists shall be pasted twice a year on June 30th and December each year. The Hospital agrees to allow at least one (1) nurse from the nurses either bargaining unit off at one WO The Hospital w i l l notify the President the Nurses' Association of the names of all nurses off work due to a work related and those if requested to do so by the affected. Prior to any nurse returning to work on a work programme, the Hospital will notify and meet with a representative of the Ontario Association and members of the local executive to discuss a back to work programme for the nurse. The Employer agrees to supply the Union with a copy of the Workers' Compensation Board's Form Report of Accidental Injury Industrial Disease) at the same time as it is sent to the Board. The Union shall be given opportunity to meet w i t h the to and amend any errors or omissions found in the Form lab coats to provided to provide scrub gowns and
Gene. TRAK agrees to xxxx all Royalty-Bearing Products sold in the United States of America under the license and rights granted by this Agreement with the word "Patent" or "Patents" or the abbreviation "Xxx." and the number of any applicable issued Initial Patent, Research Patent or Post-Research Patent.
